Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid(NM_012154.2)

Product Information

NCBI RefSeq: NM_012154.2

RefSeq ORF Size: 2580

cDNA Description: Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 2.

Gene Synonym: Argonaute 2,EIF2C2,Q10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human AGO2/Argonaute 2/EIF2C2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid HG11079-UTLN pLV-untagged 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11079-CFLN pLV-C-FLAG 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11079-CHLN pLV-C-His 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11079-CMLN pLV-C-Myc 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11079-CYLN pLV-C-HA 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11079-ACGLN pLV-C-GFPSpark 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11079-ACRLN pLV-C-OFPSpark 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11079-NFLN pLV-N-Flag 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11079-NHLN pLV-N-His 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11079-NMLN pLV-N-Myc 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11079-NYLN pLV-N-HA 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11079-ANGLN pLV-N-GFPSpark 2-3 weeks
Human AGO2/Argonaute 2/EIF2C2 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11079-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family, AGO subfamily, which is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. AGO2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Human AGO2 was unable to cleave preformed RNA duplexes and exhibited weaker binding affinity for RNA duplexes compared with the single strand RNA. The enzyme exhibited greater RNase H activity in the presence of Mn2+ compared with Mg2+. Human AGO2 exhibited weaker binding affinities and reduced cleavage activities for antisense RNAs with either a 5'-terminal hydroxyl or abasic nucleotide. In mouse hematopoiesis, AGO2 controls early development of lymphoid and erythroid cells. AGO2 is a highly specialized member of the Argonaute family with an essential nonredundant Slicer-independent function within the mammalian miRNA pathway. AGO2 regulates dFMR1 expression, and the relationship between dFMR1 and AGO2 was defined by their physical interaction and co-regulation of downstream targets. AGO2 and dFMR1 are also connected through a regulatory relationship. AGO2 is a regulator of dFMR1 expression and have clarified an important developmental role for AGO2 in the nervous system and germ line that requires dFMR1 function. In addition, AGO2 is regulated at both the transcriptional and posttranslational level, and also implicate AGO2 and enhanced micro-RNA activity in the tumorigenic progression of breast cancer cell lines.

Reference

  • O'Carroll D, et al. (2007) A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 21(16): 1999-2004.
  • Pepper AS, et al. (2009) Argonaute2 suppresses Drosophila fragile X expression preventing neurogenesis and oogenesis defects. PLoS One. 4(10): e7618.
  • Lima WF, et al. (2009) Binding and cleavage specificities of human Argonaute2. J Biol Chem. 284(38): 26017-28.
  • Adams BD, et al. (2009) Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells. Endocrinology. 150(1): 14-23.
  • Salvatore V, et al. (2010) Bacterial expression of mouse argonaute 2 for functional and mutational studies. Int J Mol Sci. 11(2): 745-53.
  • Wilson JA, et al. (2011) Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. J Virol. 85(5): 2342-50.