Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human AKT1 Gene Lentiviral ORF cDNA expression plasmid(NM_001014431.1)

Product Information

NCBI RefSeq: NM_001014431.1

RefSeq ORF Size: 1443

cDNA Description: Full length Clone DNA of Homo sapiens v-akt murine thymoma viral oncogene homolog 1.

Gene Synonym: AKT,CWS6,PKB,PKB-ALPHA,PRKBA,RAC,RAC-ALPHA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human AKT1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid HG10763-UTLN pLV-untagged 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10763-CFLN pLV-C-FLAG 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10763-CHLN pLV-C-His 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10763-CMLN pLV-C-Myc 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10763-CYLN pLV-C-HA 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10763-ACGLN pLV-C-GFPSpark 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10763-ACRLN pLV-C-OFPSpark 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10763-NFLN pLV-N-Flag 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10763-NHLN pLV-N-His 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10763-NMLN pLV-N-Myc 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10763-NYLN pLV-N-HA 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10763-ANGLN pLV-N-GFPSpark 2-3 weeks
Human AKT1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10763-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.