Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid(NM_001709.3)

Product Information

NCBI RefSeq: NM_001709.3

RefSeq ORF Size: 744

cDNA Description: Full length Clone DNA of Homo sapiens brain-derived neurotrophic factor (BDNF), transcript variant 4.

Gene Synonym: ANON2,BULN2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BDNF/ANON2 transcript variant 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid HG10068-UTLN pLV-untagged 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10068-CFLN pLV-C-FLAG 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10068-CHLN pLV-C-His 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10068-CMLN pLV-C-Myc 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10068-CYLN pLV-C-HA 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10068-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10068-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10068-NFLN pLV-N-Flag 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10068-NHLN pLV-N-His 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10068-NMLN pLV-N-Myc 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10068-NYLN pLV-N-HA 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10068-ANGLN pLV-N-GFPSpark 2-3 weeks
Human BDNF/ANON2 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10068-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

Reference

  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.