Lentiviral Vectors

More Products

Lentiviral Vector pLV-C-Flag

pLV-C-Flag Physical MapDownload sequence

Schematic of pLV-C-Flag Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-C-Flag Information Description

  Vector Name   pLV-C-Flag
  Vector Size   6705bp
  Vector Type   Lentiviral Vector
  Promoter   enhancer CMV
  Antibiotic Resistance   Ampicillin
  Protein Tag   Flag
  Sequencing Primer   Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
    Reverse: pLen-R(GAACCGGAACCCTTAAACATGT)

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.
A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.
The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.