Lentiviral Vectors

More Products

Lentiviral Vector pLV-C-GFPSpark

pLV-C-GFPSpark Physical MapDownload sequence

Schematic of pLV-C-GFPSpark Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-C-GFPSpark Information Description

Vector Name pLV-C-GFPSpark
Vector Size 7395bp
Vector Type Lentiviral Vector
Promoter enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag GFPSpark
Sequencing Primer Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
  Reverse: pLen-R(GAACCGGAACCCTTAAACATGT)

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.