Lentiviral Vectors

More Products

Lentiviral Vector pLV-N-His

pLV-N-His Physical MapDownload sequence

Schematic of pLV-N-His Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-N-His Information Description

Vector Name pLV-N-His
Vector Size 6657bp
Vector Type Lentiviral Vector
Promoter enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag His
Sequencing Primer Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.
Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.