Lentiviral Vectors

More Products

Lentiviral Vector pLV-N-OFPSpark

pLV-N-OFPSpark Physical MapDownload sequence

Schematic of pLV-N-OFPSpark Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-N-OFPSpark Information Description

Vector Name pLV-N-OFPSpark
Vector Size 7299bp
Vector Type Lentiviral Vector
Promoter enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag OFPSpark
Sequencing Primer Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
  Reverse: pLen-R(GAACCGGAACCCTTAAACATGT)

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.