Lentiviral Vectors

More Products

Lentiviral Vector pLV-SP-N-HA

pLV-SP-N-HA Physical MapDownload sequence

Schematic of pLV-SP-N-HA Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-SP-N-HA Information Description

Vector Name pLV-SP-N-HA
Vector Size 6699bp
Vector Type Lentiviral Vector
Promoter enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag HA
Sequencing Primer Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
  Reverse: pLen-R(GAACCGGAACCCTTAAACATGT)

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.
The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.