Lentiviral Vectors

More Products

Lentiviral Vector pLV-Untagged

pLV-C-Untagged Physical MapDownload sequence

Schematic of pLV-C-Untagged Multiple Cloning Sites

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-Untagged Information Description

Vector Name pLV-Untagged
Vector Size 6663bp
Vector Type Lentiviral Vector
Promoter enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag Untagged
Sequencing Primer Forward: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
  Reverse: pLen-R(GAACCGGAACCCTTAAACATGT)